Journal: Frontiers in Microbiology

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices

doi: 10.3389/fmicb.2016.01911

Figure Lengend Snippet: Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE – left part of the picture) and Western blot ( right part of the picture) results. 1,6, E. coli BL21 (DE3) negative control; 2,5, IPTG-non-induced culture; 3,4, IPTG-induced culture. 13 kDa MS2 coat protein was massively produced in the IPTG-induced culture. M, marker Spectra multicolor broad range protein ladder (Fermentas), the marker values are in kDa.

Article Snippet: To verify the production of MS2 coat protein sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was carried out using a phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) as primary antibody and Goat Anti-Rabbit IgG, Fc specific fragment (Jackson ImmunoResearch, UK) as secondary antibody.

Techniques: Polyacrylamide Gel Electrophoresis, SDS Page, Western Blot, Negative Control, Produced, Marker

Journal: Frontiers in Microbiology

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices

doi: 10.3389/fmicb.2016.01911

Figure Lengend Snippet: Transmission electron microscopy (TEM) photograph of the intact MS2 phage-like particles (MS2 PLP) present in the supernatant after ultrasonic disruption of E. coli production cells. MS2 PLP are about 27 nm in diameter. The scale is 100 nm.

Article Snippet: To verify the production of MS2 coat protein sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was carried out using a phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) as primary antibody and Goat Anti-Rabbit IgG, Fc specific fragment (Jackson ImmunoResearch, UK) as secondary antibody.

Techniques: Transmission Assay, Electron Microscopy, Disruption

Journal: Frontiers in Microbiology

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices

doi: 10.3389/fmicb.2016.01911

Figure Lengend Snippet: Result of agarose gel electrophoresis (1%) detection of MS2 phage-like particles (MS2 PLP) in three layers removed after ultracentrifugation from the tube. 1, top layer; 2, middle layer; 3, lower layer. M, marker 2-log DNA ladder (New England Biolabs, UK), the marker values are in kb. The top layer contained the highest amount of MS2 PLP (the band on the gel around 1.5 kb).

Article Snippet: To verify the production of MS2 coat protein sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was carried out using a phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) as primary antibody and Goat Anti-Rabbit IgG, Fc specific fragment (Jackson ImmunoResearch, UK) as secondary antibody.

Techniques: Agarose Gel Electrophoresis, Marker

Journal: Frontiers in Microbiology

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices

doi: 10.3389/fmicb.2016.01911

Figure Lengend Snippet: Transmission electron microscopy (TEM) photograph of the intact MS2 phage-like particles (MS2 PLP) after purification steps. The scale is 100 nm.

Article Snippet: To verify the production of MS2 coat protein sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was carried out using a phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) as primary antibody and Goat Anti-Rabbit IgG, Fc specific fragment (Jackson ImmunoResearch, UK) as secondary antibody.

Techniques: Transmission Assay, Electron Microscopy, Purification

Journal: Frontiers in Microbiology

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices

doi: 10.3389/fmicb.2016.01911

Figure Lengend Snippet: Transmission electron microscopy photograph from TEM MS2 phage-like particles (MS2 PLP) quantification against latex standard. The large black “dot” is the latex standard and the white dots are MS2 PLP. The scale is 500 nm.

Article Snippet: To verify the production of MS2 coat protein sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was carried out using a phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) as primary antibody and Goat Anti-Rabbit IgG, Fc specific fragment (Jackson ImmunoResearch, UK) as secondary antibody.

Techniques: Transmission Assay, Electron Microscopy

Journal: Frontiers in Microbiology

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices

doi: 10.3389/fmicb.2016.01911

Figure Lengend Snippet: The results of MS2 phage-like particles (MS2 PLP) quantification experiments.

Article Snippet: To verify the production of MS2 coat protein sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was carried out using a phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) as primary antibody and Goat Anti-Rabbit IgG, Fc specific fragment (Jackson ImmunoResearch, UK) as secondary antibody.

Techniques: Spectrophotometry, Concentration Assay

Journal: Frontiers in Microbiology

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices

doi: 10.3389/fmicb.2016.01911

Figure Lengend Snippet: Transmission electron microscopy photograph of homogenous and non-aggregated MS2 phage-like particles (MS2 PLP). The scale is 200 nm.

Article Snippet: To verify the production of MS2 coat protein sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was carried out using a phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) as primary antibody and Goat Anti-Rabbit IgG, Fc specific fragment (Jackson ImmunoResearch, UK) as secondary antibody.

Techniques: Transmission Assay, Electron Microscopy

Journal: Frontiers in Microbiology

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices

doi: 10.3389/fmicb.2016.01911

Figure Lengend Snippet: Extraction efficiency of MS2 phage-like particles (MS2 PLP) isolated from different types of matrices artificially contaminated with 5 × 10 6 MS2 PLP per sample.

Article Snippet: To verify the production of MS2 coat protein sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was carried out using a phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) as primary antibody and Goat Anti-Rabbit IgG, Fc specific fragment (Jackson ImmunoResearch, UK) as secondary antibody.

Techniques: Extraction, Isolation

Journal:

Article Title: Rapid Semiautomated Subtyping of Influenza Virus Species during the 2009 Swine Origin Influenza A H1N1 Virus Epidemic in Milwaukee, Wisconsin ▿

doi: 10.1128/JCM.00999-09

Figure Lengend Snippet: In silico coverage by the primers and probes used in the Seasonal assay and the H1 S-OIV assay

Article Snippet: One of the sequences not covered in silico was from one of our own isolates that we had detected with the H1 S-OIV assay and then sequenced. table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Organism Primer name Primer sequence a Target Total no. of sequences No. of hits No. of gaps Coverage (%) RSV RSV-L3 AATAAATCATAAGTCA*GTAGTA*GACCATGT L gene 16 16 0 100.0 RSV-E4 AATAAATCATAATAAGCT*GGTA*TTGA*TGCA L gene 16 16 0 100.0 RSV-FAM12 MGB-Fam-TTGAT*GCA*GG*GA*ATTCA*CA-EDQ L gene 16 16 0 100.0 Total for RSV 16 16 0 100.0 Influenza A virus INFA-L30 AATAAATCATAAGTCAGAGGTGACAGGATTGG M gene 3,767 3,723 6 99.0 INFA-E7 AATAAATCATAACTCA*TGGA*ATGGCTAAAG M gene 3,767 3,705 9 98.6 INFA-E8 AATAAATCATAACTCA*TGGA*GTGGCTAAAG M gene 3,767 3,496 9 93.0 INFA-FAM42 MGB-Fam-AAG*ACA*A*GA*CCZ*A*T*-EDQ M gene 3,767 3,760 7 100.0 Total for influenza A virus 3,767 3,677 9 97.8 Influenza B virus DIF430-L30 AATAAATCATAAGCCTTCTCCA*TCTTCTG M gene 364 282 82 100.0 DIF430-E24 AATAAATCATAAGTCGCTGTTTGGA*GACAC M gene 364 314 42 97.5 DIF430-FAM37 MGB-Fam-AGCAGGTA*GGCA*ATTGT-EDQ M gene 364 291 73 100.0 Total for influenza B virus 364 274 82 97.2 H1 (human) virus H1-L17 AATAAATCATAAGTA*GTGTCTTCACA*TTATAGCA HA gene 1,463 1,436 27 100.0 H1-E19 AATAAATCATAATGATCTCTCA*CCTTGGGTCTT HA gene 1,463 1,379 27 96.0 H1-E20 AATAAATCATAATGA*TCTCTTA*CTTTGGGTCTT HA gene 1,463 1,411 27 98.3 H1-AP593-16 MGB-AP-593-CAGAAATAGCCAAAAGAC-EDQ HA gene 1,463 1,436 27 100.0 Total for H1 (human) virus 1,463 1,411 27 98.3 H3 virus H3-L4 AATAAATCATAACCCT*GT*GCTGT*T*A*ATCA HA gene 4,016 3,906 6 97.4 H3-E9 AATAAATCATAAGA*ATAAGCA*TCTA*TTGGAC HA gene 4,016 4,004 6 99.9 H3-AP593-2 MGB-AP-593-G*G*TTTTA*CTATTGTCCAA-EDQ HA gene 4,016 4,005 6 99.9 Total for H3 virus 4,016 3,900 6 97.3 H1 virus (S-OIV) H1Sw_For652 + 22 AATAAATCATAAGTGGGGTCATCAAGATACAGCA HA gene 555 551 1 99.5 b H1Sw_Rev719-21 AATAAATCATAATGATCCCTCACTTTGGGTCTT HA gene 555 552 1 99.6 H1Sw_Probe684 + 20FAM 6-Fam-GCCGGAAATAGCAATAAGAC-BHQ1 HA gene 555 554 1 100.0 Total for H1 virus (S-OIV) 555 549 1 99.1 MS2 phage MS2-L23 AATAAATCATAAGGTCGGTA*CTAACA*TCAAG NA d NA NA NA MS2-E7 AATAAATCATAAGCA*CGTTGT*CTGGAAGTT NA NA NA NA MS2-AP593-7 c MGB-AP-593-CG*TATCCA*G*CTG*CA*AA*CT-EDQ NA NA NA NA MS2-AP593-6 c MGB-AP-593-CGTATCCA*GCTGCA*AA*CT-EDQ NA NA NA NA Open in a separate window a * indicates that the previous base is a proprietary superbase (Nanogen, Inc., Bothell, WA).

Techniques: In Silico, Sequencing, Virus

Journal: Food and Environmental Virology

Article Title: Methods for Preparation of MS2 Phage-Like Particles and Their Utilization as Process Control Viruses in RT-PCR and qRT-PCR Detection of RNA Viruses From Food Matrices and Clinical Specimens

doi: 10.1007/s12560-015-9188-2

Figure Lengend Snippet: The MS2 bacteriophage genome consists of 3569 nucleotides and encodes only four genes. The lysis gene overlaps the coat and replicase genes and is translated in the +1 reading frame

Article Snippet: The Asuragen company currently offers MS2 phage-like particles for diagnostic use under the trade mark of ArmoredRNA ® and ArmoredRNA QUANT ® .

Techniques: Lysis

Journal: Food and Environmental Virology

Article Title: Methods for Preparation of MS2 Phage-Like Particles and Their Utilization as Process Control Viruses in RT-PCR and qRT-PCR Detection of RNA Viruses From Food Matrices and Clinical Specimens

doi: 10.1007/s12560-015-9188-2

Figure Lengend Snippet: Schematic representation of the interaction of the 19 nucleotide stem-loop structure ( pac site) with the coat protein dimer. Numbers of bases are relative to the start of the MS2 replicase initiation codon AUG where A is +1. Adapted from Wei et al. a, edited

Article Snippet: The Asuragen company currently offers MS2 phage-like particles for diagnostic use under the trade mark of ArmoredRNA ® and ArmoredRNA QUANT ® .

Techniques:

Journal: Food and Environmental Virology

Article Title: Methods for Preparation of MS2 Phage-Like Particles and Their Utilization as Process Control Viruses in RT-PCR and qRT-PCR Detection of RNA Viruses From Food Matrices and Clinical Specimens

doi: 10.1007/s12560-015-9188-2

Figure Lengend Snippet: Plasmid packaging systems for production of MS2 phage-like particles

Article Snippet: The Asuragen company currently offers MS2 phage-like particles for diagnostic use under the trade mark of ArmoredRNA ® and ArmoredRNA QUANT ® .

Techniques: Plasmid Preparation, Control, Sequencing

Journal: Food and Environmental Virology

Article Title: Methods for Preparation of MS2 Phage-Like Particles and Their Utilization as Process Control Viruses in RT-PCR and qRT-PCR Detection of RNA Viruses From Food Matrices and Clinical Specimens

doi: 10.1007/s12560-015-9188-2

Figure Lengend Snippet: Schematic illustration of the purification of His-tagged MS2 phage-like particles with a Co 2+ affinity resin. Each MS2 phage-like assembly has 180 units of coat protein and each coat protein has a His 6 tag exposed outward from the phage-like assembly, allowing access of the chelated Co 2+ on the Sepharose beads to the His-tag. Adapted from Cheng et al. , edited

Article Snippet: The Asuragen company currently offers MS2 phage-like particles for diagnostic use under the trade mark of ArmoredRNA ® and ArmoredRNA QUANT ® .

Techniques: Purification

Journal: Scientific Reports

Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles

doi: 10.1038/s41598-017-17951-5

Figure Lengend Snippet: Transmission electron microscopy (TEM) photograph of purified His-tagged MS2 phage-like particles (His-tagged MS2 PLP). The scale is 100 nm.

Article Snippet: The membranes were incubated with Anti-Enterobacterio Phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) at a dilution of 1:1500 for 1 hour at room temperature, washed in PBS with 0.05% Tween-20 (PBS/T, Serva, Germany), and then incubated for 1 hour at room temperature with goat anti-rabbit IgG conjugated with HRP diluted 1:1500 (Jackson ImmunoResearch, UK).

Techniques: Transmission Assay, Electron Microscopy, Purification

Journal: Scientific Reports

Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles

doi: 10.1038/s41598-017-17951-5

Figure Lengend Snippet: Characterization of the single-chain version of the coat protein dimer containing the His-tag. ( A ) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), molecular weight of wild type MS2 bacteriophage coat protein was about 13 kDa (A1) whereas single chain version of the MS2 coat protein dimer containing the His-tag was about 28 kDa (A2); ( B ) western blot analysis using primary Anti-Enterobacterio Phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) and secondary goat anti-rabbit IgG conjugated with HRP (Jackson ImmunoResearch, UK) antibodies at wild type MS2 bacteriophage coat protein (B1) and single chain version of the MS2 coat protein dimer containing the His-tag (B2); ( C ) western blot analysis using primary anti-HisTag antibody (Pierce, Thermo Scientific, USA) and secondary goat anti-mouse IgG conjugated with HRP (Jackson ImmunoResearch) antibodies at wild type MS2 bacteriophage coat protein (C1) and single chain version of the MS2 coat protein dimer containing the His-tag (C2); ( D , E ) laser desorption ionization-time of flight mass spectrometry (MALDI-TOF) analysis of wild-type bacteriophage MS2 coat protein and single-chain version of the MS2 coat protein dimer containing the His-tag; M, marker, spectra multicolor broad range protein ladder (Fermentas); the marker values are in kDa. The figures were cropped, full length gel and blots are presented in Supplementary Figures , and .

Article Snippet: The membranes were incubated with Anti-Enterobacterio Phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) at a dilution of 1:1500 for 1 hour at room temperature, washed in PBS with 0.05% Tween-20 (PBS/T, Serva, Germany), and then incubated for 1 hour at room temperature with goat anti-rabbit IgG conjugated with HRP diluted 1:1500 (Jackson ImmunoResearch, UK).

Techniques: Polyacrylamide Gel Electrophoresis, SDS Page, Molecular Weight, Western Blot, Mass Spectrometry, Marker

Journal: Scientific Reports

Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles

doi: 10.1038/s41598-017-17951-5

Figure Lengend Snippet: Temperature stability testing of particles. ( A ) Temperature stability testing of MS2 phage-like particles (MS2 PLP) and ( B ) His-tagged MS2 phage-like particles (His-tagged MS2 PLP) using agarose gel electrophoresis; temperature values are in °C; M, marker, 2-log DNA ladder (New England Biolabs, UK); the marker values are in kb. The figures were cropped, full length gels are presented presented in Supplementary Figures and .

Article Snippet: The membranes were incubated with Anti-Enterobacterio Phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) at a dilution of 1:1500 for 1 hour at room temperature, washed in PBS with 0.05% Tween-20 (PBS/T, Serva, Germany), and then incubated for 1 hour at room temperature with goat anti-rabbit IgG conjugated with HRP diluted 1:1500 (Jackson ImmunoResearch, UK).

Techniques: Agarose Gel Electrophoresis, Marker

Journal: Scientific Reports

Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles

doi: 10.1038/s41598-017-17951-5

Figure Lengend Snippet: RT-qPCR testing of optimal method of thermal lysis of His-tagged MS2 phage-like particles (His-tagged MS2 PLP).

Article Snippet: The membranes were incubated with Anti-Enterobacterio Phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) at a dilution of 1:1500 for 1 hour at room temperature, washed in PBS with 0.05% Tween-20 (PBS/T, Serva, Germany), and then incubated for 1 hour at room temperature with goat anti-rabbit IgG conjugated with HRP diluted 1:1500 (Jackson ImmunoResearch, UK).

Techniques: Lysis, Concentration Assay

Journal: Scientific Reports

Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles

doi: 10.1038/s41598-017-17951-5

Figure Lengend Snippet: The results of RT-qPCR purity testing of His-tagged MS2 phage-like particles (His-tagged MS2 PLP) and MS2 phage-like particles (MS2 PLP).

Article Snippet: The membranes were incubated with Anti-Enterobacterio Phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) at a dilution of 1:1500 for 1 hour at room temperature, washed in PBS with 0.05% Tween-20 (PBS/T, Serva, Germany), and then incubated for 1 hour at room temperature with goat anti-rabbit IgG conjugated with HRP diluted 1:1500 (Jackson ImmunoResearch, UK).

Techniques: Concentration Assay

Journal: Scientific Reports

Article Title: One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles

doi: 10.1038/s41598-017-17951-5

Figure Lengend Snippet: Specific oligonucleotides used in present study.

Article Snippet: The membranes were incubated with Anti-Enterobacterio Phage MS2 Coat Protein polyclonal antibody (Merck Millipore, USA) at a dilution of 1:1500 for 1 hour at room temperature, washed in PBS with 0.05% Tween-20 (PBS/T, Serva, Germany), and then incubated for 1 hour at room temperature with goat anti-rabbit IgG conjugated with HRP diluted 1:1500 (Jackson ImmunoResearch, UK).

Techniques: Sequencing